I (26 M) have been in this lab for 2 years now. I have a lab mate that is so sweet, so smart, and so funny. I wake up in the morning to go to lab so i can visit her (and maybe get my work done if I get around to it lol). She is amazing in every way, inside and out, like she is so beautiful its insane.

I need advice...

1. Is this something I have to decide to let go? I will still be in my program after she moves on. So we only have the rest of the academic year together anyway.
2. She is chinese (we are both studying in the US) and very proud of her culture. While we've never discussed it, she might/probably/understandably wants someone from her own culture who has the same customs and stuff. A guy who literally speaks her language. Im just a white guy. All this to say, I am not sure if I'm even her type or not.

Nothing has happened in 2 years, and I think she's happy just being friends. I am too. She is an amazing friend. I couldn't have started my PhD without her, but I still get knots in my stomach talking to her.

Sorry if this doesnt make sense. We just got done working late in the lab, and i'm tearing up on my walk home and can't think straight.

I feel like a worthless piece of shit.

I spent countless hours writing my thesis, only to receive this feedback from my supervisor about my discussion chapter:

"I find it deeply disappointing that you that you didn't make the effort to grasp the essence of this project and its results. Anyway, it's too late."

We're preparing to submit our work to Nature, after countless hours at the bench, yet I still feel like a complete failure.

I've worked my fucking ass off for years, and somehow it's never enough.

Is this normal? Do other PhD students feel this worthless too?

Edit: Oh, and I just wanted to clarify that it's not just about this one message. It's been like this throughout my PhD, constantly feeling like I'm never good enough and getting harsh comments. This message was just the last straw, I guess...

Always avoiding columns, collecting fractions or re-racking tips

Theres some things in my lab that people are like don’t touch my stuff and like yeah sure I can order my own. But like an $800 reagent that basically anybody could use, why are we ordering 4 vials of this when we can just share?

Anyways imo this is where I stand:

Share:
West dura - why everybody gotta have their own $660 kit?
Mini Preps - really aren’t that expensive and for 250 preps everybody should be able to use this
Blot development folders - it’s a single use piece of plastic. 100 folders would go quickly, why do we need to have 600 on hand in 6 different peoples drawers? In suppose there’s a case for both sides of this though.
BCA Assay kit - simple chemicals, we need 3? Why?
Protease inhibitors - everybody gonna use it anyways
Antibodies - we shouldn’t have 3 of the same exact antibody because 3 different people are working with it. Especially loading controls like GAPDH
Lipofectamine - expensive. Sure contamination but also really expensive
Polybrene - barely use any should be general lab use
Antibiotics - everybody should get one aliquot of a master mix, no need to have multiple master mixes.
Restriction enzymes - why have multiples?
Flow routine viability dyes
OptiMEM - specifically for transfections, no reason to have 2L in the fridge when you need mL at a time (doesn’t count for those that need to culture their cells in OptiMEM)

The things like premade western gels, protein standards, HRP secondaries those are already general lab use. We gonna start ordering specific standards for everybody?

Personal -
Media bottles - contamination
Transfer/running buffer - cheap easy to have around researcher time
Midi preps - 25 preps being $400 shared lab use would go by fast.
Specific experimental drugs (though ask somebody before ordering)
Any “working solutions”
Pipettes
any experimentally created stuff - protein lysates, RNA, plasmids, etc (though also for things like empty vectors backbones etc, that should be common use and marked properly)

Things what would go by quickly like the blot folders, the midi kits, SDS Page sample buffer, having individual makes sense because it would go really fast if communal.

Idk maybe I’m trying to fix a broken system but having 3 bottles of the same ECL substrate is stupid imo and a waste of money when we don’t have a lot just to “give everybody a personal one”

Dear lab rats,

I’m about to start a PhD in polymer chemistry, and I have mixed feelings about it.

On the one hand, I’m genuinely excited! My future PI has a good reputation and seems to be a good Person. I’m also interested in the research topic, the project is well-funded, and the salary is actually quite good.

On the other hand, my entire research background so far has been in organic chemistry. I genuinely love organic chemistry and even had the chance to publish in. To be honest, I’m a little sad about leaving it behind.

What worries me most, though, is that I have practically no research experience in polymer chemistry and only a fairly basic understanding of the field. I’m therefore feeling a bit anxious about starting a PhD in an area that’s still unfamiliar to me.

Has anyone here made a similar transition from organic chemistry to polymer chemistry (or switched fields when starting their PhD)? How difficult was it to adjust, and how long did it take before you felt comfortable in your new field?

I’d really appreciate hearing about your experiences!

I’m in my mid-20s and have a BS in biology with concentration in molecular biology and few years of experience in molecular/NGS lab work. I’m considering a master’s to move into a more technical and potentially higher-paying role.

I’m open to staying in science/healthcare or moving into something completely different as well but don’t want to stay primarily in lab bench or simply move into lab management. I’m looking at areas like computational biology, engineering, CS, math/statistics, data, health technology, and other fields I may not have considered.
I’m particularly interested in finding a **niche field if possible where my existing background could give me an advantage**, rather than entering an extremely crowded general field.
I know some fields are already oversaturated at the master’s level, while others may increasingly prefer a PhD, so I’m trying to find something with a realistic path to employment and good long-term ROI.

I’m open to learning any other skill like Python, SQL, etc., and I’m also willing to complete prerequisite courses if needed. The only hard requirement is that the master’s be 100% online. I’m trying to be very careful about ROI and don’t want to spend $20–30k on a degree only to find out that entry-level jobs are extremely competitive or that the degree doesn’t add much value in terms of compensation. I’d want the degree to realistically lead to a meaningful increase in earning potential compared with staying in my current type of work, rather than spending $20–30k to end up making roughly the same income.

If you were in my position, what fields or degrees would you seriously consider for strong long-term ROI, good compensation, and career growth, and which ones would you stay away from? If you’ve been in a similar situation or transitioned from a science/lab background into a different technical field, I’d especially appreciate hearing about your experience—what path you chose, how difficult it was to break into the field, and whether the degree was ultimately worth the investment.

I’m also open to suggestions for fields or career paths I may not have considered, so any advice based on your own experience would be greatly appreciated.

Can't post video so I post the screen capture.

https://www.reddit.com/r/interesting/comments/1x94jxc/two_brain_cells_connecting_to_make_a_new_pathway/

Hello,

I wanted to post asking for advice and insight from those who currently work in a lab.
I don’t want to give too many details but, I graduated in summer 2025 with a bachelors in bioinformatics and a minor in data science at a University of California school. I got a job as a junior data analyst in September of 2025 at the same company my mom works for in a completely unrelated industry and one that I frankly do not want to work in at all. It pays good enough, and the job market is so horrible now, which is why I accepted but it’s a very corporate role and I really really miss learning, education and especially working in a lab. My current job is also in my home town and I hate it here tbh and really miss the city I went to school in. I really want to move back there so I’ve been looking at lab openings there.
My issue is I have prior lab experience from school but not much. It was just a 3 month long summer internship.

I am seeing some positions opening up in labs, junior positions that I think I qualify for since they don’t ask for much experience. But I want to ask if it’s even worth my time to apply to these or if I really stand no chance. I know the job market is still horrible and getting worse + labs are struggling to get funding, but I really want to work in a lab again and it’s my absolute dream to break into a lab role or a role at a biotech company. However it really seems impossible with how everything is looking right now :C

I guess my main question is, do I stand any chance at getting one of these jobs with only 3mo lab experience but 1+ year experience in an unrelated industry? I also can’t afford graduate school currently and don’t know if it’d be worth all the loans I’d have to take on to go to grad school. Sorry for long and maybe convoluted post, I just feel so stuck in my current career and I really miss being on the biotech path.

Hope I could make some of you giggle hehe

i’m currently on my first year and finishing up my spv’s project that can’t be used for my graduation anyways—tbh it feels like there’s no end in this tunnel and that the pressure is getting too high, so i’m thinking of moving labs

as others have adviced me i should only disclose it when the other PI have officially accepted me in. on the meantime i’m still doing responsibilities—and that includes buying more mice, treating more mice, and necropsy.

how can i leave amicably in the middle of this project if seemingly i’m the only one who was handling it all these times, and would my PI be upset now that no one else would finish this?

i thought about telling her i’m “—moving to a different direction” but i think based on our past conflicts she’d know and be upset either way

I am trying to do PCR with Platinum SuperFI II for the first time. Unfortunately, on my first try, I got no amplicon. Thermo's protocol suggests a "universal" 60C annealing temp regardless of primer sequences. My primer sequences are relatively low GC content, and sequences are as follows:

cttaaggtcgagttatataatatatttatg

cctaggtgatatatttctattagg

Prior to this, I've only ever used NEB Q5, which predicts 57C for these primers. With Q5 I've never failed to amplify a sequence from a known plasmid on the first try. Is there any chance that the "universal" annealing temperature is what messed up my PCR here?

Thanks!

We evaluated this on our own screening platform last year. Short version: the swap is workable, but not every third-party roll is up to it - and you can't just load it and run. It has to be validated first.

Four things have to hold at the same time. Low DMSO transmission, so solvent evaporation stays under control. Uniform sealing across the whole plate, especially at the edges where partial seals are easy to miss. Low extractables, so nothing leaches into the well headspace and interferes with a biochemical or cell-based readout. And roll width, tension and peel behaviour that actually match the sealer's mechanics.

You can't settle any of that from a datasheet. A film with great numbers on paper behaves differently on a different sealer, or under a different incubation condition.

How we ran it: OEM film on one plate, candidate film on another. Same compounds, same concentrations, same instrument, same incubation. Then compare Z′ stability, positive and negative control CV, solvent loss, and whether failures show up as position-dependent patterns at the plate edges. About a day.

One thing people skip: process consistency matters more than the base formulation. Coating accuracy, slitting quality, batch-to-batch tension control. Ask for batch records and incoming inspection data.

And no supplier can skip your validation and call a film equivalent for your assay. That call is yours to make.

Disclosure: I work in the lab consumables industry. General information only - please validate on your own system and instrument.

for my project i need to make a fluorescent virus. i have a plasmid with my fluorescent protein, but it has the wrong homology arms and the wrong promoter. my supervisor said i can use snap gene to simulate gibson assembly. Ultimately, i want to amplify both of my homology arms with their primers. then i need to amplify the flourescent protein with a primer that has the promoter i want? and then mix it all together to get my new plasmid. im very confused on how to do this in the software. i have never done molecular work before and am struggling with snapgene and with wrapping my head around this. when i open the gibson assembly function, i use the original plasmid as my vector and i want to remove the homology arms so i can add the ones i want from my virus template on either side of the fluorescent protein, but it wont let me select both homology arms to remove them.

I tried many methods both in Chatgpt and YouTube, it still can't stop 😭

Rao Yi at Peking university has accused on chinese social media that an editor (Steve Mao) at Cancer Cell is running bribing schemes, alleging that this editor has solicited publication for a fee of $2m RMB.

Original post in chinese linked

English is not my first language so I apologize for any mistakes :)

Hello! I'm sorry if this is the wrong place to post this, but I need help!

I work in a low-budget lab, mostly doing physicochemical analysis. I have to determine the viscosity of motor oil, and at first I thought of the Ostwald viscometer but there is also the Cannon-Fenske.

What type do you recommend??

Thank you!

I am relatively new to IPs. The practice in my lab is to lyse cells and freeze the lysate at -20 until it is ready to use. This seems like it might be a bit harsh on the proteins to me, and I’m worried any detergents in the buffer could precipitate out. I’m also trying to identify a relatively non-abundant product so I’m wondering if it’s best to just to the IP fresh. Do you typically:
- go straight into the IP
- freeze either at -80 or -20
- freeze at either -80 or -20 but snap freeze first

Any other IP lore welcomed :)

EDIT: no one in the lab seems to normalize the lysates (using a Bradford for instance) before going into the IP, do you do this usually?

Hi :) I'm not sure if this is the right place for this discussion, so apologies if not! Also the title is not a pun I promise

Let me begin with the disclaimer that this rant is largely a gender issue, as I am a woman working in research.

I'm currently in the process of getting my masters, this is my second lab I've worked in (from molecular bio to behav neurosci) and I've noticed that despite being very different labs, they have similar issues; namely, that a lot of guys who come in do not respect the women they work with.

Of course, obligatory disclaimer, not all guys, I've worked with plenty of perfectly wonderful guys.

But, I've also had a reoccurring issue of men not taking me seriously, not listening to me, even when I'm in a position of authority (I was one of two senior students in my previous lab, and am now lab manager in my current lab).

Earlier last week I was giving a lecture on our study premise, plans for the future etc. and one guy literally had his headphones in the whole time, on his phone, etc. 😭 I've had to deal with guys like this so many times I literally have a "procedure" to deal with them that I call potty training, lol.

Is this just what it's like to be a girl in this field?? Will people actually respect me if I have a PhD?? Am I doing something wrong??

I really feel the need to emphasize I have worked with plenty of perfectly respectful guys who I loved to be around, it's just also my experience that so many men I've worked with have an ego, think they know everything, etc. I'm sorry to the guys reading this I'm sure you're great lmao

edit: thank you for the kind words/commiseration!! I'm very open to advice especially from other lab girls :)

Hey fellow labrats.

I'm trying to double digest pET21a(+) plasmid with NdeI and HindIII.

Both my enzymes are from the same brand, I've checked buffer compatibility and using the buffers which is needed.

On setting up my ligation for the first time, I got a lawn growth on my control.

Then I performed sequential digestion (not NdeI -> HindIII and HindIII -> NdeI). Only set up control ligation. I got colonies even without the ligase in the reaction.

Now each time I see my gel, I see a single linearised band, but there's always a smear in the my gel band (upstream and downstream). Both when I'm checking and doing a prep gel.

I've tried almost everything at this point. I've checked my enzymes on a different vector plasmid of my labmate and I saw that they work (their clone is within the same restriction sites)

I'm doubting my plasmid prep(which I've done twice, their quality is good enough) and water (currently highly doubtful because I see smear in my labmate's clone's double digestion)

Is there anything else I'm missing on?